Free Access
Table 1
Characteristics of the primers used in this study and their references.
| Target bacteria | Primer name | Sequences (5′–3′) | Melting temperature (°C) | Expected size (bp) | References |
|---|---|---|---|---|---|
| E. tarda | EtdF | AGCGCAGCTAACGGTAAAGT | 57 | 426 | This study |
| EtfA_R | TGTAACCGTGTTGGCGTAAG | 55 | Sakai et al. (2007) | ||
| V. alginolyticus | ValF | CTCTCCCAATTCAGCCCTCTA | 56 | 773 | Ransangan and Lal (2013) |
| ValR | GACTCTTCACAACAGAACTC | 51 | Ransangan and Lal (2013) | ||
| V. anguillarum | rpoN-ang5 | GTTCATAGCATCAATGAGGAG | 51 | 519 | Demircan and Candan (2006) |
| rpoN-ang3 | GAGCAGACAATATGTTGGATG | 51 | Demircan and Candan (2006) | ||
| V. harveyi | VhF | ACGCTTGATGGCTACTGGTGGAG | 61 | 606 | Ransangan and Lal (2013) |
| VhR | CTTCGCACCTGCATCGG | 57 | Ransangan and Lal (2013) |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.