| Issue |
Aquat. Living Resour.
Volume 23, Number 1, January-March 2010
|
|
|---|---|---|
| Page(s) | 125 - 130 | |
| Section | Regular articles | |
| DOI | https://doi.org/10.1051/alr/2010003 | |
| Published online | 17 March 2010 | |
Note
Use of histopathology, PCR and in situ hybridization methods to detect the parasite Mikrocytos sp. in Pacific oyster Crassostrea gigas from the northern coast of the Yellow Sea, China
1
Environmental Science and Engineering College, Dalian Maritime University, Dalian 116026, PR China
2
Marine Environmental Ecology Department, National Marine Environmental Monitoring Center, Dalian 116023, PR China
3
Life Science and Technology College, Dalian Fisheries University, Dalian 116023, PR China
Corresponding authors: This email address is being protected from spambots. You need JavaScript enabled to view it. This email address is being protected from spambots. You need JavaScript enabled to view it.
Received:
21
May
2009
Accepted:
19
November
2009
Abstract
Mikrocytos mackini is the etiological agent of Denman Island disease, which causes significant mortalities in commercially important bivalve species, including the Pacific oyster, Crassostrea gigas. A close relative of M. mackini, Mikrocytos sp., was recently detected in oysters imported into France from Canada. In this study, we examined Pacific oysters from the northern coast of the Yellow Sea, China. Of the one hundred samples examined histologically, a microcell parasite was found in the tissues of four oysters. To identify whether the parasite was Mikrocytos sp., DNA was extracted from the oysters and polymerase chain reaction (PCR) amplifications were performed with primers (Mikrocytos-F and Mikrocytos-R), which yielded the expected 522 bp fragment. DNA sequencing of these products confirmed that they were identical to the corresponding 18S region of Mikrocytos sp. (100%) and had close similarity to M. mackini (89%). In situ hybridization (ISH) also was performed in this study, and the primer pair MM-like (CCTGTCCTATGTCGGGCAGG) hybridized with the Pacific oyster parasite. This is the first report of Mikrocytos sp. in the Pacific oyster from the coast of China. Although this study suggests a low prevalence of the parasite in China, its potential threat to aquaculture should be considered.
Key words: Parasite / Mikrocytos mackini / Mikrocytos sp. / Histology / Polymerase chain reaction / In situ hybridization / Crassostrea gigas
© EDP Sciences, IFREMER, IRD, 2010
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.
